thomasle322 thomasle322

13-10-2022
Mathematics

contestada

. A bag of potato chips weighs 154 grams. How much does this bag weigh in ounces? 1oz = 28g

Respuesta :

Otras preguntas

4. In scene 4, how is Beatrice feeling? Does she get sympathy from Hero and Margaret? What do Hero and Margaret suggest?

Una pelota se desliza hacia arriba por una pendiente se halla inicialmente a 6m de la parte más baja de dicha pendiente y tiene una velocidad de 4m/s. 5s despué

Find the measure of Arc JNFind the measure of arcJN= Find the m

2,4,8,16 arithmetic or geometric

The perimeter of a rectangular pool is 180 yes. The length is 10yds more than the width. Find the length and the width of the pool

What are eggshells made of?

A process of blood formation

how do you make hand sanitizer it's for science class

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

When Sanchez left his house this morning, his cell phone was 30% charged and it then started to lose 3% charge for each hour thereafter. Write an equation for t