00021110 00021110

11-11-2022
Mathematics

contestada

Which congruence theorem, if any, can be used to prove that the triangles are congruent?

a) SAS
b) SSS
c) HL
d) ASA
e) AAS
f) Not enough information is given to prove that the triangles are congruent.

Which congruence theorem if any can be used to prove that the triangles are congruent a SAS b SSS c HL d ASA e AAS f Not enough information is given to prove th class=

Respuesta :

Otras preguntas

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

Please help ASAP!!!!!!!!!!!!!

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Please help!!!! URGENT!!!!!!!!!!!!!!!!!!!!!

PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.