axch6yz7w2 axch6yz7w2
  • 12-11-2022
  • Mathematics
contestada

PLEASE HELP. I need both the x and y and the length of DF

PLEASE HELP I need both the x and y and the length of DF class=

Respuesta :

Otras preguntas

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
what rule does static electricity follow
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
How much money, in dollars, does one mole of nickels represent?
Why did the french revolution happen and who's fault was it
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?