sharidler sharidler
  • 15-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Respuesta :

Otras preguntas

Genes that are linked together _____.
The weight of bodies may change somewhat from one location to another as a result of the variation
on one of the outings though the brobdingnagian countryside, Gulliver walks on a small path through a field. during this walk on the small path, how does Gulliv
If the cost is $100 plus a variable cost, the function is C(n)= 100+(2-0.01n)n. the selling price is $2.50 per unit. the revenue function is R(n)=2.50n. determi
Solve for x. I need this answer by 8:30am tomorrow also.
The passage of energy in a one way direction through and ecosystem is called ___
What is 150/1 divided by 2/5
Unlike painting in the west, icons did not __________ biblical events.
I need help evaluating a Permutations 3P2?
Jack walks 30 miles at 30 degrees north of east, then walks 30 miles at 45 degrees north of east. how many miles east of his starting point will he end up?