GabeTay1744 GabeTay1744

15-02-2024
Business

contestada

The airport sells thirty different kinds of donuts. Sixteen of these kinds can only be purchased as small donuts and the other fourteen kinds can only be purchased as large donuts. How many kinds of donuts does the airport sell in total?A) 14B) 16C) 30D) 44

Respuesta :

Otras preguntas

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

How many O atoms are there in 1.51×10^23 molecules of trifluoroacetic acid, C2HF3O2?

Which of the following would BEST describe native people's approach to the varied and sometimes harsh environments in which they lived? (A) They developed socie

True or false 49 is a irrational number

Mimi cycled a total of 12 kilometers by making 3 trips to work. After 4 trips to work, how many kilometers will Mimi have cycled in total?

how do number and gender affect adjectives in Spanish. write your answer in english

Write a paragraph with in 100 words about fast food

Identify the slope using the following two points: (-1, 6) and (-3, 10)

The New Zealand government created what in 1975 to investigate Maori Claims that the british had violated the treaty of Waitangi?A. A rite of passage B. PakehaC

will give brainliest