pinktigerpop70701 pinktigerpop70701
  • 13-03-2024
  • Biology
contestada

Replicate the following gene strand, and then transcribe the template strand:
GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter abbreviations for the amino acids
(if you do it correctly it should spell something).

Respuesta :

Otras preguntas

plz hurry i need help!!! The ecosystem with the most concentrated selection of diverse plants and animals in the world is the __________, located in Latin Ame
#1-10 Complete Predicates
who knows what 0.976 + 0.99
Compare and contrast endocytosis and excocytosis
How did farming lead to new types of activities
What is the probability that a couple will have a girl, a boy, a girl, and a boy in that specific order?
luke was playing checking with a friend . the ratio of game won was 9:8.if luke won 18 games,how many games did his friend win
12x=7y-10yis this a linear equation?what is it in standard form?
Sam wants to have 21 diamond pieces.he needs to find how many of these pieces will be yellow if 5/7 of the diamond pieces are yellow.what is an equivalent fract
4232 divided by 18 also estimate