Jaye255 Jaye255
  • 15-09-2018
  • Social Studies
contestada

In all English colonies, a white male could only vote if he was a

Respuesta :

joshsk8main
joshsk8main joshsk8main
  • 15-09-2018

Owned land or was part of the government i hope this helps :)


Answer Link

Otras preguntas

in what area of Europe were the majority of warsaw pact countries
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
what are 2 points on the graph for 6x-5y=25
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
what was paul revere failures
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w