isabelleng0721 isabelleng0721
  • 13-10-2018
  • Mathematics
contestada

−(7y+0.6)=3.6−y
PLEASE ANSWER QUICKLY

Respuesta :

rosalina5
rosalina5 rosalina5
  • 13-10-2018
y= -1/2. final answer. Your welcome
Answer Link

Otras preguntas

6x – 9 = 33 Check please and thank you ​
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
pls pls pls, I beg you to answer this question only if you know the correct answer please please please I beg you
What does the metaphor “Fame is a Fickle Food” mean? What is the theme of this poem?
what finally convinces Jeannette that she must leave , and that she must do so herself
Regular hexagon ABCDEF is inscribed in circle X and has an apothem that is 6√3 inches long. Use the length of the apothem to calculate the exact length of the r
Hypothetically, if a slave owner dies, what would happen to his slaves?
Complementary, Supplementary or neither?​
Pls help !! What contributed to the idea that people have rights and that the power of government should be limited?
Need help getting the answer to the question below.