KyleighFarley KyleighFarley

13-11-2018
Geography

contestada

True or False: Tourism has helped the economics in the Caribbean Islands but has also had negative effects.

True or False Tourism has helped the economics in the Caribbean Islands but has also had negative effects class=

Respuesta :

PhAnToMXYZ PhAnToMXYZ

13-11-2018

The answer is true. Tourism produced an estimated 14 percent of the region’s Gross Domestic Product in 2013, but, the ships that bring in the tourists dump waste into the ocean

Answer Link

Otras preguntas

50 PTS!!!!! NEED ANSWER WITHIN 5 MINS!!!!!! Select the correct answer. y - 6 = 4(x - 4) Which of the following shows a graph of the equation above?

A battery consists of solution. and an electrolyte, wh Select one: O a. Two dissimilar metals b. An insulator material separating the metals c. Both A and B O d

Find by means of a vector (quantity) diagram the resultant of two forces of 7N and 3N acting at right angle to one another.

State the name given to reflected sound waves

A flask with a volume of 125.0 mL contains air with a density of 1.241 g/L.What is the mass of the air contained in the flask?

Membership in the Volunteers Club increased by 15% from last year. If the number of members last year was m, complete a simplified expression to represent the n

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

10pa is acting on an area of 0.5m2

2/Citez quatre produits qui étaient échangés en Afrique au XVI. 2pts

What are the coordinates of the point on the directed line segment from (-6, 8)(−6,8) to (-2, -8)(−2,−8) that partitions the segment into a ratio of 5 to 3? Ple