cherryskies cherryskies
  • 04-04-2019
  • Social Studies
contestada

Why is the battle for Quebec important in Canada’s history? *20 POINTS*

Respuesta :

bm42400
bm42400 bm42400
  • 04-04-2019

The Battle of Quebec was an important part of the famous Invasion of Canada campaign during the American Revolutionary War, and it took place on December 31st, 1775 at Quebec City. This battle was the first major war defeat for the Americans. and one that came with very heavy losses. The purpose of this invasion into Canada was partly to attract the population of Canada into supporting the American interests in the war.  

Answer Link

Otras preguntas

where are the three parts of an atom located
How do you put allele in a sentence
why is it critical to your cells to be near capillaries
i need help with #3
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Fossils are most commonly found in which type of rock?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want