knug knug
  • 02-06-2019
  • Mathematics
contestada

What’s the square root of 36?

Respuesta :

jayantmanem jayantmanem
  • 02-06-2019

Answer:

6

Step-by-step explanation:

the square root is basically exponents 6*6 is 6^2 which is 36.  

Answer Link
abi47 abi47
  • 02-06-2019
The answer is 6. Six times six is 36.
Answer Link

Otras preguntas

Describe the purpose of the sistema de castas, why it failed, and its impact on how race is viewed in the Hispanic world.
Why is having empathy important as a peer reviewer?
Which of the following equations is equivalent to the equation 6x – y = 1? A. y = 6x – 1 B. y = 6x + 1 C. y = -6x + 1 D. y = -6x – 1
eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
The Solar System is made up of eight planets, numerous comets, asteroids, and moons, and the Sun. The force that holds all of these objects together is _______.
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?
I need help with this question which letter is it?
Which describes a financial product offered by insurance companies that, in return for an investment, provides fixed payments each month for the remainder of a
What do the Navy SEALs and the Green Berets have in common?
Physical activity not related to a persons job is defined as?