sriyakveerapaneni15 sriyakveerapaneni15
  • 01-07-2019
  • Mathematics
contestada

Which is the approximate solution for the system of equations 8x - 10y = -23 and 9x + 10y = -16?

Respuesta :

tomvillatorres
tomvillatorres tomvillatorres
  • 01-07-2019

Answer:

see page for answer........

Ver imagen tomvillatorres
Ver imagen tomvillatorres
Answer Link

Otras preguntas

There are 56 runners in a race. How many ways can the runners finish first, second, and third?
Suppose that 100 people enter a contest and that different winners are selected at random for first, second, and third prizes. what is the probability that kuma
two numbers that are the same distance from zero on a number line, but are in oposite directions. (-2 and 2)
f(x) = 2cos(x) and g(x) = 3 sin (x+pi). Using complete sentences, explain how to find the maximum value for each function and determine which function has the l
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Bias is --------- a0 in favor of or against one thing, person, or group compared with another.
Q4 Q12.) Solve the following logarithmic equation. Be sure to reject any value of x that is not in the domain of the original logarithmic expression. Give the e
Please help! I don't know how to do this!
What is one problem that was solved during Sojourner Truth's lifetime (1797-1883)?A)prison reformB)universal suffrageC)abolition of slaveryD)property rights of
Karen found that the solution to x – 7 + 5x = 36 is x = 6. Which of these could be the way she found the solution? Add x + 5x, subtract 7 from both sides of t