vincentotienoogutu20 vincentotienoogutu20
  • 02-11-2019
  • History
contestada

Discuss traditional beliefs in some African communities that affected persons with disability in 18th century

Respuesta :

anjalipriya1 anjalipriya1
  • 11-11-2019

Answer:

The traditional beliefs in some African communities are as evil powers, curse etc.

Explanation:

1. They belief that the disability is a curse for the people and people with the disabilities are hopeless.

2. They belief that the evil powers of witches or bad people will harm them for their needs.

3.  They belief that their ancestors force them for the marriage and violence the society norms.

4. They belief that they receive a curse from the god.

Answer Link

Otras preguntas

i need help with #3
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help with Algebra 1
in what area of Europe were the majority of warsaw pact countries
What were the driving forces behind the industrial revolution
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
The Panama Canal connects what two bodies of water?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud