drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

all state legislators are the same. true or false

Which is not an example of a symbol a word, picture, object, or opinion?

does anyone know how to to explain slope in a easy way

what is the future tense format sentences?

Can someone help me . Thanks . Work is due tomorrow

The _____ era was an artistic movement in the late 1800s that encouraged imagination and individualism.

find the intercepts for the graph of the equation 8x-4y=24. type an ordered pair for y and x

all state legislators are the same. true or false

When used as an energy source in a nuclear power plant, uranium is burned in a similar way as one would burn wood or coal for energy. a. True b. False

Can you think of 7 ways to make 7 using arithmetic?