xgjddjdinexubd xgjddjdinexubd
  • 01-12-2019
  • Chemistry
contestada

Please help! Thank you!

Please help Thank you class=

Respuesta :

koolbro koolbro
  • 01-12-2019
It has to be oxygen as it has a charge of -2 and magnesium has a charge of +2 so when they bond it would be MgO
Answer Link

Otras preguntas

find the volume of the cylinder! Use 3.14 for pi- round your answer to the tenths place !! Will mark b if correct:)
Which is a valid food chain ?
You and your friend each have a canvas of the same size. You divide your canvas into 5 sections and paint 3 of them. Your friend divides her canvas into 7 secti
Can some show the steps and the answer please I really need help tell me how you get it and the answer
CAN ANYONE HELP ME ASAP AND THANKS:)
Can someone please help me with this need verified answer pls
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Barak’s dough is too sticky. What is the likely cause of this problem? A. too much flour used B. too much kneading C. too much sugar D. flour was too weak
Los áticos son los pisos más _______. 1. altos 2. altas 3. alta
helllllllpppppQuestion 7 of 10 Here is a model of the Sun-Earth system at a certain point in Earth's orbit around the Sun. Axis 对联 Rotation axis Arctic Trop of