Jareth07 Jareth07
  • 03-12-2019
  • Mathematics
contestada

2/5,8/20: is it a proportion?

Respuesta :

KKmax123 KKmax123
  • 03-12-2019

Answer:

Step-by-step explanation:

you need to simplify 8/20

8/20  can be put into the greatest common factor which is 4

then divide both sides by 4 this equals to 2/5

So yes they are

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Help pl0x, Algebra 1
what are the 2 major types of cofactors?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
What is the additive inverse of -4a
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?