NiyomureziAline11 NiyomureziAline11

13-06-2016
Mathematics

contestada

simplify (3a4-2a2+5a-10)-(2a4+5a-2)

Respuesta :

cecegarciaa cecegarciaa

13-06-2016

I simplified and this is what i got (a^4-2a^2-8 )

Answer Link

Otras preguntas

Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9

Let f(x) = 2x + 2. Solve f−1(x) when x = 4. a. 1 b.3 c. 4 d.10

The stroop effect demonstrates people's inability to ignore the ______ of words.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

What was one of the two major goals that the national organization for women work towards when it was first founded?

(hc) "in the government of this commonwealth, the legislative department shall never exercise the executive and judicial powers, or either of them. the executiv

__________ is a good example of congressional casework. analysis of an incumbent's policy positions prior to a debate analysis of water quality within a distric

(8n+1)(6n-3) please solve in quadratic formula