ddwinavelar89K ddwinavelar89K

15-06-2016
English

contestada

In a written document, what does style refer to ?

Respuesta :

WorldlyGlass49 WorldlyGlass49

15-06-2016

Style refers to chosen syntactical and lexical units. It is the way one writes and tries to convey his/her meaning.

Answer Link

Otras preguntas

Sophie deposited $12,000 in an account that earned simple interest annually. - She did not make additional deposits; she did not make withdrawals. -At the end o

Please give a step-by-step solution of 2x^2 +12x = 6 (by completing the square)

The measure of ADB is 162º. What is the measure of <EAB

What are the solutions to this quadratic equation? 5x2-7x-18=0

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Solve the system of equations by graphing y = 6 y = 3x - 3

Anna's car requires 5 1/2 gallons of gasoline to make 4 round trips to work and back. If her car can travel 24 miles per gallon of gasoline, how far, in miles i

Which equation is not equivalent to 2x + 14 = 4x– 6 14 + 6 = 2x -2x= 20 2x – 4x= -20 X = 10

The design industry has benefitted enormously from all of the following EXCEPT: the explosion in fashion and home design shows the increased means of bringing d

Would you expect polyethylene to polymerize at a faster or slower rate than polymethylmethacrylate? Explain