monroechittum monroechittum

03-03-2020
History

contestada

How did the American Revolution indirectly aid the French in their struggle
for independence

Respuesta :

tbaker2205 tbaker2205

03-03-2020

Answer:

idk either

Explanation:

Answer Link

Otras preguntas

Which of the following statements best describes a survey question? A question you will ask the people in your sample. A question designed to collect a single d

Within the Cherokee Nation, the Treaty Party, led by Major Ridge and his son John, favored ______. a. resistance to the Indian Removal Act b. rebuilding the Che

16. Explain how this would impact the gravity between Earth and the moon. (1 or 2 sentences)

I need help with this can someone please help?

(1)Now that we have met Lady Macbeth, one of Shakespeare's most infamous female characters, what is your impression of her? Explain? (2) In what ways is she pus

Identifying Themes in Literary Texts: Question 1 Read the excerpt from "Friend or Foe?" The other family members were shuttled up the basement stairs to a waiti

what would happen if there were no rules for your school

write any four features of analytical engine

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

The diagram shows the development of the oocyte and the follicle during the menstrual cycle identify at which stage in the cycle the hormone levels are at their