rubycuevas18 rubycuevas18
  • 04-03-2020
  • English
contestada

Which statement uses parallel structure? Find your nearest

Respuesta :

kaleselapsley kaleselapsley
  • 04-03-2020

Explanation:parallelism or parallel structure is a literary device that consists in the repetition of the grammatical structure of different words or phrases in a sentence or paragraph, in order to emphasize an idea or to create an impact in the audience. From the given options, the one that uses parallel structure is the corresponding  because it uses the same kind of words (adjectives) in the listed elements (powerful, affordable, and reliable).

Answer Link

Otras preguntas

how can you write 0.45 as fraction and a percentage ,please show work
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
how to i do 7/16÷(31/2÷1/2)
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the most common type of vegetation throughout Latin America
i need help with #3
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
What kind of problems did increased urbanization cause? During time of industrial revolution
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers