stup1dPerson stup1dPerson

02-04-2020
Biology

contestada

A body of water formed when ocean water floods continents is called an

Respuesta :

zeennahakorede zeennahakorede

02-04-2020

Answer:

A strait

Explanation:

The Suez Canal is an example

Answer Link

pkinskid pkinskid

02-04-2020

Answer: It is called a Strait

Answer Link

Otras preguntas

The root word graph means to _____. speak, write, read

Write the polynomial in standard form. then name the polynomial based on its degree and number of terms.2 – 11x2 – 8x + 6x2

1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help

-( x + 4 ) = 2x + 35

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

I need the answer and the path work ok

A collection of dimes and quarters is worth 15.25. there are 103 coins in all. how many of each are there

What was OPEC protesting when it imposed it's embargo?

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou