LeslieSegovia2005 LeslieSegovia2005

03-04-2020
Biology

contestada

How do insects help a plant to reproduce?

Respuesta :

allisonsnow23 allisonsnow23

08-04-2020

Answer: insects helps plants reproduction through pollution, which further leads to fertilization, flower and seed production.

Explanation:

Answer Link

Otras preguntas

Complete the word using the correct prefix or suffix, which matches the meaning in parentheses. One's mental attitude will often produce re for another perso

What is the difference between creep and a landslide

who was pessimistic about the african american experience during the harlem renaissance

50 × 1% = _____ ..................................................................

Please Help me!!!! Place the type of paper with the most appropriate style of

what are some rapid changes to the earths surface. what are some slow changes to the earths surface

Which characterizes perfect competition in a free enterprise system? (will mark you as brainlyest) A. One firm is dominant C. Government regulates all decisi

which literary device involves the repetition of vowel sounds across successive or closely placed words?

Which state abbreviation should be used in the following address?Ms. Hannah Lin 555 W. 18th St. Santa Ana, _____ 99838CALICACalif.Californ.

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se