kimberlyburgos11 kimberlyburgos11

04-04-2020
English

contestada

Choose the correct figurative language device for the following quote?

"A book is a loaded gun in the house next door."

Respuesta :

cerritosslp cerritosslp

04-04-2020

The correct figurative language is a metaphor.

Answer Link

Otras preguntas

A rectangular bin is going to be made with a volume of 646 cm^3. The base of the bin will be a square and the top will be open. The cost of the material for the

What does the term Homo sapiens mean?

If 4.1 × 1021 electrons pass through a 40 Ω resistor in 5 min, what is the potential difference across the resistor? The fundamental charge is 1.602 × 10−19 C .

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

PLS HELP WITH QUESTION

If you begin an exercise program and burn 5 cal per minute by walking how many hours of walking per day would you have to do in two weeks to lose 5 pounds you m

I need help, please

A 4.00kg counterweight is attached to a light cord, which is would around a spool. The spool is a uniform solid cylinder of radius 8.00cm and mass 2.00kg. (a) W

An environmental agency worries that many cars may be violating clean air emissions standards. The agency hopes to check a sample of vehicles in order to estima

During the Playoff the schools football team has on average 30% their games than during the regular season. The average for this year's playoffs attendance was