kaelynbox
kaelynbox kaelynbox
  • 14-04-2020
  • Mathematics
contestada


19 cm
6 cm
Find the area of the figure.

Respuesta :

imawolf
imawolf imawolf
  • 14-04-2020

Answer:

144cm

Explanation:

19 × 6 = 144cm

Answer Link
madelynegeck
madelynegeck madelynegeck
  • 14-04-2020
Answer: 114cm squared

Explanation: formula for area: length•width
19•6=114

Answer Link

Otras preguntas

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
the size of Texas is approximately 270000 square miles this ever represented approximately 41% of the size of Alaska approximately how many square miles make up
Write the equivalent expressions pllzzzz need so much help both plzzz
Solve for x: 3x − 24 = 81 (5 points) a)57/3 b)105/3 c)57 d)105
Write a paragraph that describes the path that one drop of water takes as it moves through the water cycle. In your paragraph, include at least two changes in t
Which statement is true? a. Kush was located in modern-day Egypt. b. Kush was conquered by Aksum. c. Kush never controlled Egypt. d. Kush was invaded by Rome.
Which are true of the function f(x) = 49 (1/7)x? Check all that apply. A:The domain is the set of all real numbers. B:The range is the set of all real numbers.
Write a paragraph about soil conservation to be read as a public service announcement on radio stations.
in base sport like kickball what does a force out mean
What is 9 divided by 7488? Thank you if you help! :)