emails4emma emails4emma

01-05-2020
Mathematics

contestada

Which ratio is different from the others? 2 to 13 , 13:2 , 2:13 , 2/13

Respuesta :

Pmoney10 Pmoney10

01-05-2020

Answer:

13/2

Step-by-step explanation:

It just is

Answer Link

changomango2007 changomango2007

01-05-2020

Answer:

13:2

Step-by-step explanation:

13:2 because it is in a different order than the other ratio.

hope this helps!!

Answer Link

Otras preguntas

The transtheoretical model includes a stage called termination. a. True b. False

-6.8 + (-12) + (-72.3).

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

Suppose n is odd. find the cube of n and divide it by 4. what possible remainders could occur? check all the possible ones and none of the impossible ones.

When the term F.O.B. shipping point is used, title passes when the

What is the main reason night driving is more difficult than daytime driving?

allied needs in world war 1 spurred the growth of what industry in Seattle, Tacoma, and Vancouver?A: commercial fishing B: shipbuilding C: textilesD: weapons de

(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you attended the us public high school the highest status crowds were probably the