Iwritewithpencils
Iwritewithpencils Iwritewithpencils
  • 14-05-2020
  • Biology
contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105
andyk38105 andyk38105
  • 14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

pa answer po dito thank younonsense-reportcorrect answer-brainliest​
What is the answer with explaining
2) If a brick has a length of 13.77 cm, a width of 8.50 cm, and a height of 5.12 cm: a) What is the volume of the brick? b) If the brick has a mass of 895.3 g,
Committees that consider a proposed bill have the authority to
Which of these should be creative to help scientist make reliable conclusions
X and Y are in partnership with capital contributions of $50000 and $30000 respectively. The partnership agreement provides that profits are to be shared in pro
Find the probability that the spinner will land on gray and then purple
1. Swadeshi Andollan. short note​
Determine what type of model best fits the given situation: The temperature of a cup of coffee decreases by 5 F every 20 minutes. A. none of these B. quadratic
what are the types of senes