sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

How the federal government supported nationalism in their intersections with the states

Graph: f(x) = -√x Step 1: Evaluate the function to find three points. f(0) = -1 0 1 -2 2 1 -2 9 y 2 6 x x y

Solve The Equation. 6x-6= -9(4x-1/3)

Graph: f(x) = -√x Step 1: Evaluate the function to find three points. f(0) = -1 0 1 -2 2 1 -2 9 y 2 6 x x y

Identify the domain and range x -5 -2 1 5 7 y 10 11 4 10 15

Select the values that make the inequality m 4 true. Then write an equivalent inequality, in terms of m. (Numbers written in order from least to greatest going

Although most predicted Phillip to ______ his father, he surprised them by reversing several of his fathers more malevolent policies. dislike resemble influence

For each function f, find f^-1 and f^-1(5). f={(-1,5), (0,0), (2,6)}

I went shopping for a new car. the suggested manufacturers price is $26,985. With discounts for first time car buyer, being a college graduate, and the Labor Da

For each function f, find f^-1 and f^-1(5). f={(-1,5), (0,0), (2,6)}