daniusca2006
daniusca2006 daniusca2006
  • 12-06-2020
  • History
contestada

Could there ever be another American civil war?
Why or why not ??

Respuesta :

jaredclancy23
jaredclancy23 jaredclancy23
  • 12-06-2020
Not a civil war civil is past time.
Answer Link

Otras preguntas

find the greatest common divisor of 9 and 27
A mudflow consists of debris with a large amount of
I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50
Four hundred people live on a pacific island and 16 are homozygous recessive for a trait that has only two different types of alleles in the population. how man
The name for people who stay in one place like civilization of china and kroea
who invented the glass harmonica
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
Social disparity was one of the major causes of french revolution. Justify the statement
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
FIRST ONE TO ANSWER CORRECT GETS BRAINLYIST! Which characteristics of Dickinson’s style are evident in "The Snow”? Check all that apply. - four-line stanzas -