PokemanGos PokemanGos
  • 03-09-2016
  • Mathematics
contestada

a real world situation that represents-85÷15

Respuesta :

katie6wpg katie6wpg
  • 03-09-2016
Martha is throwing a party and she is inviting 15 of her friends.  She is giving candy to her friends as the party favor.  When she went to the store, she bought a package of 85 pieces of candy.  If Martha wants to give each friend the same amount of candy, how many pieces does each friend get?

Answer: (85/15) = 5 with 10 pieces left over (also equals 5 2/3)

Hope this helps! :)
Answer Link
MaMariah
MaMariah MaMariah
  • 03-09-2016
The answer is going to be -5.7
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Why were the committees of correspondence powerful?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
How did the mountains in Greece contribute to the rise of city-states?
A generator stores electric current. Explain why you agree or disagree with this statement
four yardequal Blank feet
a antonym for biosphere