Naynay124 Naynay124
  • 03-11-2014
  • Mathematics
contestada

What is the sum of 3/2x and 7/4x

Respuesta :

lekhagummalla
lekhagummalla lekhagummalla
  • 03-11-2014


3/2x +7/4x = ...........

3/2x(4/4)+7/4x(2/2)

12/8x+14/8x = 26/8x

26/8x = 13/4x(3.25x)  

Answer Link
Irian Irian
  • 03-11-2014
3/2x + 7/4x
Dina a common denominator which is 4, so multiply 3/2 by 2 to get the bottom number to be 4.

Expressed: 6/4x+7/4x
Now add them: 11/4x
Answer Link

Otras preguntas

Ramon bikes every afternoon. He travels 4 1/4 miles in 1/4 hour. At what rate dies Ramon ride his bike in miles per hour
PLEASE HELP ME QUICK WILL GIVE BRAINLIEST
Danni walked 2 miles, and Wendi walked 10,500 feet. Which statement is accurate?
What did critics complain about Theodore Roosevelt? I can't seem to find any material on it. Any help, please?
if n is parallel to m find the value of x and the value of y?
An osha investigation of valid employee complaints of alleged violations of standards or of unsafe or unhealthful working conditions is a ____ priority.
a line segment that has both endpoints on the circle and passes through the center of the circle
Are viruses alive? This question is debated among scientists throughout the world. Scientific researchers discovered agents that behaved like bacteria, causing
Who can help me with number 14
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg