MarynrydmaMic
MarynrydmaMic MarynrydmaMic
  • 14-09-2016
  • Arts
contestada

Explain why science cannot determine whether or not a painting is a great work of art.

Respuesta :

Hussain514 Hussain514
  • 16-09-2016

Science can only answer questions about the natural world that can be determined through observation and experimentation. Science cannot tell you what is good, bad, beautiful, or ugly.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
What is the difference between "Herr" and "Herrn"?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
How do you write fifty-seven thousand,eighteen. In standard form
define concentric circles
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?