johanygarcia18 johanygarcia18

14-09-2020
Mathematics

contestada

what is a simplified fraction of -4/17?

Respuesta :

salmffg2 salmffg2

14-09-2020

I think there is no simplified fractions for this number it will be the same -4/17

Answer Link

Otras preguntas

In a kindergarten there are x bicycles and y tricycles. There are enough for each of the 120 children to have a ride at the same time. One of the children count

What did isabel want so badly that she came across to the fiesta in esperanza rising

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Writing Equations of Lines of Best Fit

Salut Quelqu'un peut me donner la qualification et l'interprétation de la phrase suivante du livre "la peau de chagrin"? " un regard empreint d’une froide ironi

Problem 10 The position-time graph below represents the motion of South's basketball coach during the last sixteen seconds of overtime during this past weekend'

Pratton Drive 36 km for every 3 L of gas they put in her car

The integer 5 makes which of the following equation false

A piecewise function is represented by the graph below. On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line

Please find what the rent per unit needs to be to have a Net Operating Income (NOI) of $100,000. Assumptions Please use the following assumptions below: Rent pe