vargasgirls vargasgirls

12-10-2020
Mathematics

contestada

Item 21
Question 1
Write and solve an inequality that represents the value of x.

Area <30 cm2

Respuesta :

hiwhy12 hiwhy12

19-10-2020

Answer:

1st: 5x

2nd: 6ft

Step-by-step explanation:

I really don't know how just got the answer right.

Answer Link

Otras preguntas

If the measures of two opposite angles of a parallelogram are represented by 3x+40 and x+50 what is the measure of each angle of the parallelogram

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

What does President Lincoln express he did not want to do?

In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?

CAN SOMEONE HELP ME PLEASE ?

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

Hallucinogens can cause __________. A. extremely high speed B. slowing down or stopping in the middle of a freeway C. heightened focus on the driving task D. A

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat