i1nizam1i
i1nizam1i i1nizam1i
  • 13-10-2020
  • Biology
contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA



What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

zorsip
zorsip zorsip
  • 13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Which accurately describes a letter written during the time a historical event occurred?
How did European affairs complicate the internal political and diplomatic problems of the new country (US)?
1. A scientific hypothesis can become a theory if ______. A) the entire community accepts it B) the hypothesis is tested extensively and competing hypothesis ar
The Puritan communities in New England in the 1600s mainly emphasized
After Hitler came to power in 1933, he blamed Germany's defeat in World War I on A. Communists and American imperialists. B. Communists and Socialists. C. Jews
The U.S. government openly stated that they would view any European interference in Latin America as
Who is W. E. B. Du Bois?
why did Germany abandon the "Sussex pledge"
how does arachne feel about her weaving skill
The complex numbers corresponding to the endpoints of one diagonal of a square drawn on a complex plane are 1 + 2i and -2 – i. What are the complex numbers cor