i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the complementary DNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the complementary DNA sequence for the DNA strand above class=

Respuesta :

KurdishPotato KurdishPotato

13-10-2020

Answer:

Option D)

Explanation:

In the DNA strand A comes accross Tç and C comes across G

The option justifies this rule is D)

Answer Link

13-10-2020

The picture doesn't work for me.. sorrry

Answer Link

Otras preguntas

Edwin Hubble is most famous for? A. building a giant space telescope B. discovering the Virgo Supercluster C. figuring out the structure of the milky way galaxy

Which is the best example of an objective summary of the theme "truth is hard to discern” that is further developed in Act V of Hamlet? When Hamlet and Laertes

When reviewing your essay, which steps should you take?

When ypu ask for directions to post a office,you are asking about

One of the poor decisions that has plagued yahoo!'s financial performance was its reluctance to transition its offerings to mobile devices. this is an example o

Which sentence uses a pronoun in the possessive case?

Alicia es ___ de Alejandro.Lisa es ___ de Arturo y Beatriz.Carlos es ___ de Manuel. Lisa, hermana de Carlos es ___ de Lisa y Andrés. Martín es ___ de Enrique. L

What is the vertex of the graph of y = 3x2 + 2x + 1?

What was a factor keeping Europeans out of interior Africa until the late 1800s? A. Disease B. Rough ground C. Dangerous animals D. All of the above

What is the first step in both aerobic and anaerobic respiration?