angelhypnosb14 angelhypnosb14

13-10-2020
Mathematics

contestada

What is the distance from point Yto wx in the figure below?
w
36 Z 15 X
39
152
y
A. Cannot be determined
B. 153
C. 15.2
D. 15
E. 3
O F. 7.5

What is the distance from point Yto wx in the figure below w 36 Z 15 X 39 152 y A Cannot be determined B 153 C 152 D 15 E 3 O F 75 class=

Respuesta :

10gonzalezj11 10gonzalezj11

26-10-2020

Answer:15

Step-by-step explanation:

Answer Link

Otras preguntas

A parent that is heterozygous for a trait is crossed with a parent that is homozygous dominant for the trait, as shown in the Punnett square. Which genotype be

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

difference between steam distillation and fractional distillation

Write the reaction showing the decay of Mn-56

Ways to improve sustainability in the maritime sector

(−100) ÷ {200 − (14 − (−16) ) × 5} + 10 =

If you pour hot soup into a bowl, and the bowl stays cool to the touch, you can assume that A the bowl is a good insulator of heat. B the bowl is a good conduct

is 5,12,14 a pythagorean triple

You are Ahmed, head boy of Apex Public School, write a letter to Sharjah chess authority expressing your school's readiness to host the school chess tournament.

What is the main idea of the passage? Aquaculture is the science and practice of growing fish for food that is gaining popularity. Although aquaculture has seri