puglife231
puglife231 puglife231
  • 14-10-2020
  • Mathematics
contestada

Solve by taking the square too of both sides.
3(c+3)^2-81=0

Solve by taking the square too of both sides 3c32810 class=

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 14-10-2020

Answer:

x = -3 ±3sqrt(3)

Step-by-step explanation:

3(x+3)^2-81=0

Add 81 to each side

3(x+3)^2=81

Divide each side by 3

3/3(x+3)^2=81/3

(x+3)^2=27

Take the square root of each side

sqrt ((x+3)^2)=±sqrt(27)

x+3 =±sqrt(9*3)

x+3 =±sqrt(9)*sqrt(3)

x+3 =±3sqrt(3)

Subtract 3 from each side

x = -3 ±3sqrt(3)

Answer Link

Otras preguntas

A researcher has developed a measure of a person's ability to detect colors. He finds the measure is not related to a person's spelling ability, which is a diff
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
List five requirements for a healthful Environment.
How many cups do they use with 20 tablespoons of honey
What things are stressful in your life and how do you handle that stress ? How could you be more effective in dealing with stress ?
Explain why the stars look different between Jane and John
1,762 rounded to 1 significant figure is 2,000 This means that rounding to 1 significant figure is the same as rounding to the nearest thousand. explain how the
What was the first Western European country Germany invaded? Netherlands Poland France Belgium
Which systems advocates that the suffering of the worker should be made lighter through intervention by the government?
After a 20% discount, you pay $140 for a skateboard. What was the original price ?