grayvalerie59
grayvalerie59 grayvalerie59
  • 11-11-2020
  • Mathematics
contestada

The domain of the following relation: R: {(-3,4), (5,0), (1,5), (2,8), (5,10)} is (1 point)

a. {-3,1,2,5}
b. {4,0,5,8,10}
c. {-3,5,1,2,5}
d. No domain exists​

Respuesta :

hhghhyyyfff hhghhyyyfff
  • 11-11-2020
X’s are domain and y’s are range therefore the answer is a.
Answer Link

Otras preguntas

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart
In a standard normal curve, what percentile corresponds to a z-score of 2.0?
Many obstetricians date the onset of pregnancy from the date: select one: a. of conception. b. of the woman's last menstrual period. c. of implantation. d. when
Which hormone is essential to our ability to maintain our fluid levels?
4/y+2 - 9/y-2 = 9/y^2-4
Identify the specific sensory receptors for each of the five common senses.
What did president wilson's wife make sure was on the white house lawn?
What is - 3/8 divided by 7/12 a. - 7/32 b. - 32/7 c. - 14/9 d. - 9/14
Application of force with movement is called _______________ exercise.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat