gi4gikiaebanNe gi4gikiaebanNe

11-10-2016
Physics

contestada

Gravity is affected by...
A) force
B) force and distance
C) force and mass
D) mass and distance

Respuesta :

kaivalyashenoy kaivalyashenoy

07-01-2017

mass and distance
force /pull of gravity decreases with the increase in separation between the two bodies
the amount of gravity an object possesses is proportional to the mass of that object.

Answer Link

Otras preguntas

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile

Round 46.895 to the nearest tenth

Write expression using the distributive property to find the product of 7 times 63

how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420

which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be