jamariondrake jamariondrake

01-12-2020
Mathematics

contestada

Ann has $300 to spend. She gets a game system for 85 and games cost 12 each. How many games can she buy

Respuesta :

mattlittlestu mattlittlestu

01-12-2020

Answer:

17 games

Step-by-step explanation:

$300-85=215

215÷12= appx17

Answer Link

Otras preguntas

caleb and his father left for the butterfly farden at 10:32a.m. they had lunch and went to the garden. they arrived back home at 3:11 p.m. how long were they go

Which of the following sentences is correctly punctuated?

Claire marveled at her little brother’s flawless dive. It looked effortless now, but she knew he had spent weeks perfecting the arch of his body and the point o

The immediate cause of the French and Indian War was a conflict over __________.

Which type of rhetorical device is used in the lines, "While some have prospered beyond imagination in this global economy, middle-class Americans—as well as th

Which of the following ehr applications may be more beneficial and efficient for the patient?

what kind of map tells us what is happening below earths surface?

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

What gains did women make in the field of education? Describe at least two.

Identify which equation is a graph of a vertical line? 4x = y, x = 4 , y = 4, x = 4y