kki33877
kki33877 kki33877
  • 01-12-2020
  • Mathematics
contestada

You know x is a number less than 4. Select all the inequalities that must be true.

x 2

Respuesta :

swatuna21
swatuna21 swatuna21
  • 01-12-2020

Answer:

X<4 (-infinty,3)

Step-by-step explanation:

It is this because it is all number that is less then 4 which mean it is 3 and below.

Answer Link

Otras preguntas

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.
Which type of oscillation would most likely produce an electromagnetic wave?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Can someone please help me understand this?!?! i dont know what to even do. Write an equation for the line parallel to the given line that contains C. C(4,7); y
Please help I'm trying to figure out 4-15 but i don't know how to.
A major weakness of the new constitution was the bill of rights. a. True b. False
How did the Hellenistic kings spread Greek culture
4 (2x-6)=10x-6. solve for x
A sharp type of pain from the abdomen that travels along neural routes
Sid is packing crushed ice into a cone-shaped cup. The cone has a height of 5 in. Its base has a diameter of 4 in. What is the volume of the cone?