anthonyadly79 anthonyadly79
  • 02-12-2020
  • Mathematics
contestada

A carpenter cut a 6 ½-ft. board into 3/4-ft. sections. What is the number of whole sections he cut?

Respuesta :

simon22811
simon22811 simon22811
  • 02-12-2020

Answer:

8

Step-by-step explanation:

This man is cutting 6.5 ft of wood into pieces that are .75 ft long.

Divide 6.5/.75 and there's ur answer chief

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
In a law office, the average number of billed hours per day was 150 last year. In the first 85 days of this year, the average number of billed hours per day is
A data set has these values: 7,9,9, 11, 11, 11, 11, 13, 13, 15. A histogram of the distribution is shown. 4 Which statement does not describe the data set? 3 Fr
Re-order the premises in each of the arguments to show that the conclusion follows as a valid consequence from the premises. It may be helpful to rewrite the st
Pleasee helpppp meeee pleasee
Please help I’m failing.
For a scientific experiment a physicist must make sure that the temperature of a metal does not get colder than -100c or the metal will not be useable. The phys
help pls! ill mark brainliest if correct!
What question led scientists to separate plants and fungi into two distinct kingdoms? A. Does the organism have cells? B. Does the organism reproduce? C. Does t
Which date has the longest daylight and the shortest darkness