hugoiscoollol
hugoiscoollol hugoiscoollol
  • 03-12-2020
  • Mathematics
contestada

PLEASE HELP BRO
xxxxxxxxxx

PLEASE HELP BRO xxxxxxxxxx class=

Respuesta :

hayhay8504
hayhay8504 hayhay8504
  • 03-12-2020

Answer:

D

Step-by-step explanation:

Answer Link

Otras preguntas

plot the distance and time data for distance the train traveled on the grid below. plot the distance on the vertical axis and time on horizontal axis. label the
When I was walking down the street, I saw a woman man in the face. O a) to hit Ob) hitting Oc) hit O d) was hitting
What’s the surface area of this prism ?
Martin Luther King Jr. often spoke of a day in the future when he hoped that his children would be judged not by their skin color but instead by their character
Evaluate the expression and enter your answer. 2 • |6 + 2|
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
what is representing screenZ 00m meat ting for 18+ fuun ent,er this following c0de ok​ meating c0de =>> 817 7338 2361 pasc0de=>> ft11vU​
List ways we can deal with invasive species? ( I know this is simple but like I'm too lazy to do it rn)
Write a Travelogue about a Visit to East Africa, Central Africa, Southern Africa, or West Africa in the 1800s
-68 as a quotient of integers to show that it is rational