cheyyy5 cheyyy5
  • 14-01-2021
  • Biology
contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya
angelomontoya angelomontoya
  • 14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

why were the baiga,s not willing to work as labourers​
In the accompanying diagram, isosceles triangle ABC has coordinates A(-4,0), B(4,0), C(0,4). Find the area of ABC.
What are the vertex and x-intercepts of the graph of the function below?y= x^2 - 6x-7A. Vertex: (3,-16); Intercepts: x = 1, -7B. Vertex: (3, -16); Intercepts: x
Which of the following events is impossible?
What is the area of the triangle
what is n id 3.2=1.06^n
Please help me with number 2.
Question 1 (Fill-In-The-Blank Worth 2 points) Fill in the blank with the correct preterite form of the verb IR. Ayer yo ___________ al hotel. Answer for Blank
Name a living crature without an evolutionary history
please help me on the first question