karithao2939
karithao2939 karithao2939
  • 14-01-2021
  • Physics
contestada

I need help!!! What is the answer!!

I need help What is the answer class=

Respuesta :

kayla8642
kayla8642 kayla8642
  • 14-01-2021

Answer:

A I think hope it helps!!

Answer Link

Otras preguntas

i need help solving this problem
Lab Report Physical Properties It's time to complete your Lab Report. Save the lab to your computer with the correct unit number, lab name, and your name at the
What should I include in a conclusion about the roman empire's social economic and political aspects? I wrote about how Christianity affected it, how inflation
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Compare and contrast Prokaryotic and Eukaryotic cells.
5) 3 people exercising on an oval. It takes Tony 2 minutes to complete a cycle by bicycle, Malcolm 4 minutes by running and Julie 6 minutes by walking. If they
If 10 were added to each of the values in a data set that originally had a standard deviation of 6, the standard deviation of the resulting data would be 16.
9 = 3y + 37 + 4y solve for y and simplify as much as possible
What improvement to the caravel made it easier to steer than the older galleon?
Why does Shakespeare use the chorus to communicate the informa- tion and emotion contained in the Prologue, rather than using specific individual characters? Sh