ereanser ereanser
  • 15-01-2021
  • Biology
contestada

AGTACTACGTTGCTTAGTGCTAGCTTAGCTATA

How many codons are there in this strand, from left to right?

Respuesta :

autumnstoddard84
autumnstoddard84 autumnstoddard84
  • 15-01-2021
Answer: should be 11!

Explanation: every 3 letters = a codon
There are 33 codons, divide it by 3 and get 11! Or you can count by 3’s until the end
Answer Link

Otras preguntas

What good things did roosevelt do for the great depression?
Which northern colonies seemed to allow the most freedom?
The difference between twice a number and 11 is -23
Which monomials are perfect squares? Check all that apply. 6x2 9x8 16x9 25x12 36x16
The ___________________ took place when William and Mary overthrew James II. It gained this name because no fight took place.
Auden's "Musée des Beaux Arts," Williams's "Landscape with the Fall of Icarus," and Brueghel's Landscape with the Fall of Icarus all share which theme? A. Pain
Select the choice which best identifies the given passage from "The Cask of Amontillado." "At the most remote end of the crypt there appeared another less spaci
define what an element is.
What action by a nurse researcher will help eliminate bias on the dependent variable?
Factor the expression completely over the complex numbers. x4−625