sneumann15 sneumann15
  • 01-11-2016
  • Chemistry
contestada

which of these can be classified as a pure substance? 1.Pumpkin Pie 2.Salt 3.Ice Tea 4. Salt Water

Respuesta :

znk
znk znk
  • 30-08-2018

2. Salt

“1. Pumpkin pie” is incorrect. You can see two phases — the crust and the filling, and each of these is also a mixture.

“3. Iced tea” is incorrect. You can see two phases — the ice and the tea, and the tea is a solution of several substances in water.

“4. Salt water” is incorrect. Although it is homogeneous, it consists of two substances — salt and water.

Answer Link

Otras preguntas

Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
In which system of government would states function independently of each other?
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What property is shown by the equation? 1. 0 ÷ (–6) = 0
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
What is the additive inverse of -4a
Please help me with this two step math problem! THANK YOU !!!!!!!!
how do i find the angles on a kite?