Tyler0213 Tyler0213

03-02-2021
History

contestada

Which religions began in the same area? (Hint:there are two different pairs)

Respuesta :

scriptix scriptix

03-02-2021

Answer:

Buddhism and Hinduism

Explanation:

Answer Link

Otras preguntas

PLS HELP NEED ANSWER IN LESS THAN A DAY What is the value of g, the gravitational field strength, at the surface of the planet Venus? Round your answer to two d

Helppppp please i need help

Pets Survey Pets No Pets Total 36 42 38 116 Answer: 6th grade 19 7th grade 16 8th grade 23 Total 17 26 15 58 58 What percent of the 7th graders don't have pet?

Help me please on #4 I will mark brainzillest

. Identify the term that best describes the italicized word. LaKeisha was the only student (who knew which )book had been assigned. proper adjective O indefinit

Which of the following is a good summary of the passage above? A. If you throw a tennis ball really hard, it will travel very fast when it leaves your hand. T

A bag holds 23 cups of sugar. A recipe for chocolate chips cookies uses 1 cups of sugar. How many batches of chocolate chip cookies can be made with one bag of

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

65. Which of the following could represent the side lengths of a triangle? Check all that apply. A. 6, 10, 14 B. 12, 15, 29 C. 8, 8, 11 D. 19, 24, 40 E. 9, 17,

A nurse is preparing to administer dextrose 5% water (D5W) 250 ml IV to infuse over 2 hr. The nurse should set the IV pump to deliver how many ml/hr?