gwendalynn96
gwendalynn96 gwendalynn96
  • 14-02-2021
  • Mathematics
contestada

can you help me please ​

can you help me please class=

Respuesta :

10n31y
10n31y 10n31y
  • 14-02-2021

tan = opp/adj

tan 20 = opp/10

x = 10(tan 20)

x = 3.63....

x = 3.6 cm

Answer Link
merlinman1234 merlinman1234
  • 14-02-2021
The answer is for x= 3.6
Answer Link

Otras preguntas

What is Gibbs free energy?!
Evaluate the expression. (6-2)[(2+3)+4 A) 9 B) 13 C) 24 D)36
The shorter leg of a right triangle is 8 centimeters less than the other leg. Find the length of the two legs if the hypotenuse is 40.
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
ulia demonstrated the formation of a type of rock. She mixed egg, salt, and herbs and cooked the mixture over a flame. The egg turned into an omelet. The format
What evidence would indicate whether this animal is aquatic or terrestrial in mollusca?
What gains did women make in the field of education? Describe at least two.
What trait of a society can prevent cultural blending?
Which set of statistics best describes a typical home value in Maya's neighborhood and how the values vary?
For which of the following reasons did Greece benefit from its city-states?