ahmedibrahimshamsja ahmedibrahimshamsja
  • 01-03-2021
  • Mathematics
contestada

1+ [-1] - 3 if u answer this i will give u brainly

Respuesta :

cartertownsend44 cartertownsend44
  • 01-03-2021

Answer:

the answer is -3

Step-by-step explanation:

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
Where did middle names come from
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
What was George Washington's nickname?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based